Learning goals:
- expose you to a bunch of syntax around shell use & scripting.
- show you the proximal possibilities of shell use & scripting.
- give you some useful tricks!
- provide fodder for discussion, so please ask questions!
Points to make:
- almost everything we'll do today has existed since 70s or 80s - so pre-Python & R.
- I use almost everything below on a ~weekly basis.
- I learn new things every year ('set -e', for example).
- For me, anything more complicated than what is below => Python (easier to test, handle errors, etc.).
Also note! "Data Therapy" sessions 3-5pm Wed, in the Center for Companion Animal Health (Bennett Room, 2nd floor, CCAH). Keurig will be provided
We'll starting at the end of the shell genomics lesson.
Make sure you have the test data! Download and unpack:
https://s3-us-west-1.amazonaws.com/dib-training.ucdavis.edu/shell-data.zip
and set your current working directory to be the top level dir, 'data/'.
We'll be posting code snippets to:
https://public.etherpad-mozilla.org/p/2017-jan-adv-beginner-shell
Lisa Cohen will also be talking about HPC qsub scripts:
/~https://github.com/ngs-docs/2016-adv-begin-shell-genomics/blob/master/ucd-farm-intro.md
So, if we do 'ls', we see a bunch of stuff. We didn't create this folder. How do we figure out what's in it?
Here, 'find' is your first friend:
find . -type d
This walks systematically (recursively) through all files underneath '.', finds all directories (type d), and prints them (assumed, if not other actions).
We'll come back to 'find' later, when we use it for finding files.
Let's go into the MiSeq directory:
cd MiSeq
and take a look with ls.
For our first task, let's pretend that we want to rename all of the fastq files to be .fq files instead. Here, we get to use two of my favorite commands - 'for' and 'basename'.
'for' lets you do something to every file in a list. To see it in action:
for i in *.fastq do echo $i done
This is running the command 'echo' for every value of the variable 'i', which is set (one by one) to all the values in the expression '*.fastq'.
If we want to get rid of the extension '.fastq', we can use the 'basename' command:
for i in *.fastq do basename $i .fastq done
Now, this doesn't actually rename the files - it just prints out the name, with the suffix '.fastq' removed. To rename the files, we need to capture the new name in a variable:
for i in *.fastq do newname=$(basename $i .fastq).fq echo $newname done
What $( ... )
does is run the command in the middle, and then replace the
$( )
with the value of running the command.
Now we have the old name ($i) and the new name ($newname) and we're ready to write the rename command --
for i in *.fastq do newname=$(basename $i .fastq).fq echo mv $i $newname done
Q: why did I use 'echo' here?
Now that we're pretty sure it all looks good, let's run it for realz:
for i in *.fastq do newname=$(basename $i .fastq).fq mv $i $newname done
and voila, we have renamed all the files!
Side note: you may see backquotes used instead of $(...)
. Same thing.
Let's also get rid of the annoying '_001' that's at the end of the files. basename is all fine and good with the end of files, but what do we do about things in the middle? Now we get to use another one of my favorite commands -- 'cut'.
What 'cut' does is slide and dice strings. So, for example,
echo hello, world | cut -c5-
will give you 'o, world'.
But this is kind of a strange construction! What's going on?
Well, 'cut' expects to take a bunch of lines of input from a file. By default it is happy to take them in from stdin ("standard input"), so you can specify '-' and give it some input via a pipe, which is what we're doing with echo:
We're taking the output of 'echo hello, world' and sending it to the
input of cut with the |
command ('pipe').
You've probably already seen this with head or tail, but many UNIX commands take stdin and stdout.
Let's construct the cut command we want to use. If we look at the names of the files, and we want to remove 001 only, we can see that each filename has a bunch of fields separated by '_'. So we can ask 'cut' to pay attention to the first four fields, and omit the fifth, around the separator (or delimiter) '_':
echo F3D141_S207_L001_R1_001.fq | cut -d_ -f1-4
That looks about right -- let's put it into a for loop:
for i in *.fq do echo $i | cut -d_ -f1-4 done
Good - now assign it to a variable and append an ending:
for i in *.fq do newname=$(echo $i | cut -d_ -f1-4).fq echo $newname done
and now construct the 'mv' command:
for i in *.fq do newname=$(echo $i | cut -d_ -f1-4).fq echo mv $i $newname done
and if that looks right, run it:
for i in *.fq do newname=$(echo $i | cut -d_ -f1-4).fq mv $i $newname done
Ta-da! You've renamed all your files.
Let's do something quite useful - subset a bunch of FASTQ files.
If you look at one of the FASTQ files with head,
head F3D0_S188_L001_R1.fq
you'll see that it's full of FASTQ sequencing records. Often I want to run a bioinformatices pipeline on some small set of records first, before running it on the full set, just to make sure all the commands work. So I'd like to subset all of these files without modifying the originals.
First, let's make sure the originals are read-only:
chmod u-w *.fq
Now, let's make a 'subset' directory:
mkdir subset
Now, to subset each file, we want to run a 'head' with an argument that is the total number of lines we want to take. In this case, it should be a multiple of 4, because FASTQ records have 4 lines each. So let's plan to take the first 100 lines of each file by using 'head -400'.
The for loop will now look something like:
for i in *.fq do echo "head -400 $i > subset/$i" done
If that command looks right, run it for realz:
for i in *.fq do head -400 $i > subset/$i done
and voila, you have your subsets!
Challenge exercise: can you rename all of your files in subset/ to have 'subset.fq' at the end?
(Work in small groups; start from working code; there are several ways to do it, all that matters is getting there.)
Variables:
You can use either
MY${varname}SUBSET
would expand ${varname} and then put MY .. SUBSET on either end, while
MY$varnameSUBSET
would try to put MY in front of $varnameSUBSET which won't work.
(Unknown/uncreated variables give nothing.)
---
We used "$varname" above - what happens if we use ''?
(Variables are interpreted inside of "", and not inside of ''.)
Pipes and redirection:
To redirect stdin and stdout, you can use:
> - send stdout to a file < - take stdin from a file | - take stdout from first command and make it stdin for second command >> - appends stdout to a previously-existing file
stderr (errors) can be redirected:
2> - send stderr to a file
and you can also say:
>& - to send all output to a file
Editing on the command line:
Most prompts support 'readline'-style editing. This uses emacs control keys.
Type something out; then type CTRL-a. Now type CTRL-e. Beginning and end!
Up arrows to recall previous command, left/right arrows, etc.
Another useful command along with 'basename' is 'dirname'. Any idea what it does?
Let's go back to the 'data' directory and play around with loops some more.
cd ..
'if' acts on things conditionally:
for i in * do if [ -f $i ]; then echo $i is a file elif [ -d $i ]; then echo $i is a directory fi done
but what the heck is this [ ]
notation? That's actually running
the 'test' command; try 'help test | less' to see the docs. This is a
weird syntax that lets you do all sorts of useful things with files --
I usually use it to get rid of empty files:
touch emptyfile.txt
to create an empty file, and then:
for i in * do if [ \! -s $i ]; then echo rm $i fi done
...and as you can see here, I'm using '!' to say 'not'.
Let's create two scripts (you can use 'nano' here if you want) -- in 'success.sh', put:
#! /bin/bash echo mesucceed exit 0
and in 'fail.sh', put:
#! /bin/bash echo mefail exit 1
You can do this with 'heredocs' --
cat > success.sh <<EOF #! /bin/bash echo mesucceed exit 0 EOF cat > fail.sh <<EOF #! /bin/bash echo mefail exit 1 EOF
Now make them executable --
chmod +x success.sh fail.sh
(Somewhat counterintuitively, an exit status of 0 means "success" in UNIX land.)
You can now use this to chain commands with &&
and ||
--
./success.sh && echo this succeeded || echo this failed ./fail.sh && echo this succeeded || echo this failed
You can do this with R and python scripts too -- in R, you set the
exit status of a script with quit(status=0, save='no')
and in
Python with sys.exit(0)
. Any failure of the script due to an
exception will automatically set the exit status to non-zero.
The exit status of the previous command can be examined with $?
--
./success.sh if [ $? -eq 0 ]; then echo succ; fi ./success.sh if [ $? -ne 0 ]; then echo fail; fi
Always put 'set -e' at the top.
Sometimes put 'set -x' at the top.
You can take in command line parameters with '$1', '$2', etc. '$*' gives you all of them at once.
Scripts exit in a subshell and can't modify your environment variables. If you want to modify your environment, you need to use '.' or 'source'.
Subshells are ways to group commands with ( ... ).
You can use to do line continuation in scripts (in R and Python, too!)
History tricks:
!! - run previous command !-1 - run command-before-previous command (!-2 etc.) !$ - replace with the last word on the previous line !n - run the nth command in your 'history'
Qsub trick: build a command environment (WORKDIR etc) in a library script, then source that.
screen is awesome (so is tmux). But do they work on Windows?
- break the task down into multiple commands
- put commands things in shell scripts, run in serial
- use intermediate i/o files to figure out what's going on!
- use echo to debug!
The 'find' command is like a whole 'nother world, but it is an awesome one.
Print all files:
find . -type f
Print all files w/details:
find . -type f -ls
Find all files not in git directories:
find . -name .git -prune -o -type f -print
Find all directories in the current directory:
find * -prune -type d -print
...and get their disk usage:
find * -prune -type d -exec du -skh {} \;
Here, '-exec' runs the command specified up until the \;
, and replaces
the {} with the filename.
Same result, different command:
find . -depth 1 -type d -exec du -skh {} \;
Find all files larger than 100k:
find . -size +100k -print
Find all files that were changed within the last 10 minutes:
find . -ctime -10m
(...and do things to them with -exec ;).
Run 'grep -l' to find all files containing the string 'CGTTATCCGGATTTATTGGGTTTA':
find . -type f -exec grep -q CGTTATCCGGATTTATTGGGTTTA {} \; -print
(What's the difference between this and 'grep -l CGTTATCCGGATTTATTGGGTTTA *'?)
Note, you can use -a (and) and -o (or), along with \(
and \)
,
to group conditions:
find . \( \( -type f -size +100k \) -o \( -type f -size -1k \) \) -print
...so it's basically all programming...
Note that you can 'exec' a Python, R, or shell script.
Challenge exercise: how would you copy all files containing a specific string ('CGTTATCCGGATTTATTGGGTTTA', say) into a new directory? And what are the pros (and cons) of your approach?
(Work in small groups; start from working code, say, the 'find' command above; there are several ways to do it, all that matters is getting there.)
- sort (and sort -n)
- grep
- wc
- special characters and tricky filenames
Google (and especially stackoverflow) is your friend.